84 6. Supplementary information Table 2 SI Appendix. Designation and whereabouts of the islets on which data collection occurred. RP = 'Roche Percée' nesting area. GLS = 'Grand Lagon Sud' nesting area. ID site name nesting area latitude longitude perimeter length (m) RP Roche Percée RP -21.61229 165.46461 2525 1 Atire GLS -22.52199 166.56038 510 2 Redika GLS -22.51612 166.61308 1170 3 Vua GLS -22.57814 166.74750 1040 4 Uatio GLS -22.70903 166.79533 917 5 Uaterembi GLS -22.67954 166.81175 1037 6 Nge GLS -22.69262 166.85078 873 7 Gi GLS -22.72121 166.85162 1174 8 Nda GLS -22.84567 166.87730 604 9 Uie GLS -22.72086 166.91259 637 Table 3 SI Appendix. Primer sequence and PCR amplification of the mitochondrial control region. mtDNA primer designation mtDNA Primer sequence LCM15382 GCTTAACCCTAAAGCATTGG H950g GTCTCGGATTTAGGGGTTT Thermocycling profile consisted of an initial denaturing step of 95 °C for 5’. It was followed by 35 cycles (94 °C for 1’, 52 °C for 1’, 72 °C for 1’15’) and ended with a final extension step of 72 °C for 10’.
RkJQdWJsaXNoZXIy MjE1NDI=